Direkt zum Inhalt

Rechnen mit DNA

Ein Computer der Zukunft könnte flüssig sein – aber ganz ohne Quanteneffekte. Moleküle, die der Natur abgeschaut sind, wirken als kleine Rechenmaschinen.


Was denkt man sich bei dem Wort "Computer"? Tastatur, Bildschirm, vielleicht sogar den Mikroprozessor, das elektronische Bauteil aus Silicium, das die wesentliche Arbeit macht. An diese Vorstellung haben wir uns gewöhnt. Aber muß das so sein? Der Computer in Ihrem Kopf, mit dem Sie diese Zeilen lesen, hat wenig Ähnlichkeit mit einem PC. Vielleicht ist unsere Vorstellung von Rechnern doch zu begrenzt. Was wäre, wenn sie allgegenwärtig in den verschiedensten Formen vorkämen? Kann es einen flüssigen Computer geben, in dem Moleküle sich gegenseitig beeinflussen und dadurch Berechnungen anstellen? Die Antwort lautet ja. Und hier beginnt die Geschichte vom DNA-Computer.



Die Biologie wird neu entdeckt



Meine Rolle in dieser Geschichte begann 1993, als ich zum ersten Mal ein molekularbiologisches Labor betrat. Obwohl ich Mathematiker und Informatiker bin, hatte ich Forschungen zur Immunschwächekrankheit AIDS angestellt und bin nach wie vor von der Bedeutung meiner Ergebnisse überzeugt. Leider gelang es mir nicht, die Fachleute für meine Ideen zu interessieren. Um überzeugender mitreden zu können, beschloß ich, mich intensiver mit der Biologie des AIDS-Erregers HIV zu befassen. So geriet ich in das Molekularbiologielabor und erlernte unter der Anleitung von Nickolas Chelyapov (der inzwischen leitender Wissenschaftler in meinem eigenen Labor ist) die Methoden der modernen Biologie.

Ich war fasziniert. Mit eigenen Händen konnte ich Moleküle der Erbsubstanz DNA (Desoxyribonucleinsäure) erschaffen, die in der Natur nicht vorkamen. Und indem ich sie in Bakterien einschleuste, wo sie als Baupläne für Proteine wirkten, konnte ich die Eigenschaften der Mikroben verändern.

Derweil las ich das klassisch gewordene Buch "Molecular Biology of the Gene". Einer der Autoren ist James D. Watson, der gemeinsam mit Francis H. C. Crick die Doppelhelix-Struktur der DNA entdeckt hat. Da endlich korrigierte ich mein Vorurteil aus meiner Studienzeit an der Universität von Kalifornien in Berkeley: Offensichtlich war Biologie nicht nur die Wissenschaft vom Vergammeln von Lebensmitteln im Kühlschrank, sondern so tiefsinnig und erklärungsmächtig wie die Physik; denn es ist echte Mathematik darin enthalten. Es geht um die in der DNA gespeicherte Information und ihre Verarbeitung: Zeichenketten aus den vier Elementen A, T, G und C; die Buchstaben stehen für die Hauptkomponenten der Bausteine, die Basen Adenin, Thymin, Guanin und Cytosin. Diese Basen sind entlang eines Rückgrats zu einem langen Strang aufgereiht wie eine Kette von Buchstaben. Ein DNA-Molekül besteht aus zwei solchen Strängen; dabei steht jeder Base aus dem einen Strang eine bestimmte, die komplementäre Base aus dem anderen Strang gegenüber: A paart sich stets mit T und C mit G (Bild 1).

Spätabends im Bett geriet ich in Watsons Buch an die Stelle, wo die DNA-Polymerase beschrieben wird, die Königin der Enzyme und die Urkraft des Lebens. Unter geeigneten Bedingungen erzeugt DNA-Polymerase zu einem DNA-Einzelstrang einen dazu komplementären. Zum Beispiel erzeugt sie zu einem Strang mit der Sequenz CATGTC einen neuen mit der Sequenz GTACAG. Nach dem gleichen Muster bekommt der ehemalige Gegenstrang einen neuen Partner gestrickt, und das ursprüngliche doppelsträngige Molekül hat sich verdoppelt. Ohne diese DNA-Replikation könnte sich keine Zelle und letztlich auch kein Mensch vermehren. Für einen strengen Verfechter des Reduktionismus liegt das Wesen des Lebens in der Vervielfältigung von DNA durch die Polymerase.

Es handelt sich um eine faszinierende kleine Nanomaschine, die aus einem einzigen Molekül besteht. Sie heftet sich an einen DNA-Strang, gleitet daran entlang, liest dabei eine Base nach der anderen ab und fügt deren Komplement samt dem entsprechenden Stück Rückgrat dem neuen DNA-Strang an: Sie schreibt gewissermaßen eine Negativkopie des Strangs.

Noch in die Bewunderung des phantastischen Enzyms versunken, entdeckte ich plötzlich eine Parallele zu einem ganz anderen Gebiet. Der englische Mathematiker Alan M. Turing (1912 bis 1954) – sowie unabhängig von ihm Kurt Gödel (1906 bis 1978), Alonzo Church (1903 bis 1995) und Stephen C. Kleene (1909 bis 1994) – hatte ab 1936 den Begriff der Berechenbarkeit einer exakten Analyse unterzogen. Diese rein theoretischen Arbeiten entstanden etwa zehn Jahre vor den ersten Computern und lieferten einige der wichtigsten mathematischen Erkenntnisse des zwanzigsten Jahrhunderts (siehe "Der Einbruch des Zufalls in die Zahlentheorie" von Gregory J. Chaitin, Spektrum der Wissenschaft, September 1988, Seite 62).

Für seine Untersuchungen hatte Turing sich eine Maschine ausgedacht, die heute seinen Namen trägt. Es ist ein Denkmodell, das zu realisieren sinnlos wäre – für Berechnungen in größerem Umfang wäre eine Turing-Maschine denkbar ungeeignet –, das vielmehr durch seine geniale Einfachheit und Durchschaubarkeit die Theorie vorangebracht hat (siehe "Turingmaschinen" von John E. Hopcroft, Spektrum der Wissenschaft, Juli 1984, Seite 34).

Eine Version seiner hypothetischen Maschine besteht aus zwei Magnetbändern und einem Mechanismus namens endliche Steuereinheit (finite control), der sich gleichzeitig entlang beider Bänder bewegen kann. Eines der Bänder gilt als Eingabeband; von ihm wird nur abgelesen, während die Steuereinheit das andere Band, das Ausgabeband, sowohl ablesen als auch beschreiben kann. Es ist ein leichtes, sie so zu programmieren, daß sie eine Folge aus den Zeichen A, T, G und C vom Eingabeband liest und deren Komplement auf das Ausgabeband schreibt. Offensichtlich tut die DNA-Polymerase im wesentlichen dasselbe wie eine Turing-Maschine.

Diese Übereinstimmung gewinnt ihre eigentliche Tragweite erst aus einer Aussage, die als Churchsche These berühmt wurde. Turings Spielzeug-Computer ist berechnungsuniversell: Alles, was überhaupt berechenbar ist, kann auch von dieser unglaublich einfachen Maschine berechnet werden – ein komplementärer DNA-Strang, die Zerlegung einer ganzen Zahl in Faktoren, der günstigste nächste Zug bei einem Schachspiel und so weiter. Wenn also die DNA-Polymerase Eigenschaften einer Turing-Maschine hätte ... Bei diesem Gedanken fuhr ich im Bett hoch, erschreckte meine Frau Lori mit dem Ausruf "Donnerwetter, die Dinger könnten ja rechnen!" und verbrachte den Rest der Nacht mit Überlegungen, wie man mit DNA Probleme lösen könnte.

Meine erste Idee war eine Art Turing-Maschine mit einem Enzym anstelle der endlichen Steuereinheit. Bemerkenswerterweise hatten fast zehn Jahre zuvor Charles H. Bennett und Rolf Landauer von IBM nahezu die gleiche Idee gehabt (siehe deren Artikel "Grundsätzliche physikalische Grenzen beim Berechnen", Spektrum der Wissenschaft, September 1985, Seite 94). Leider gab es dafür nur ein funktionierendes Beispiel, eben die DNA-Polymerase, und man konnte sich nicht recht vorstellen, wie ein Enzym andere, kompliziertere Berechnungsprobleme bewältigen könnte.

Hier macht sich eine entscheidende Eigenschaft der Biotechnologen bemerkbar: Wir sind eine Bande von Dieben. Weit davon entfernt, diese unglaublichen Molekularmaschinen wie die DNA-Polymerase selbst erschaffen zu können, sind wir darauf angewiesen, sie den Zellen zu stehlen. Die ganze Branche lebt von diesem Diebesgut; aber das ist glücklicherweise sehr reichhaltig. In drei oder vier Milliarden Jahren biologischer Evolution ist eine Fülle natürlicher Nanomaschinen entstanden; aber eine zum Schachspielen war nicht darunter. Wozu auch unter natürlichen Bedingungen? Wenn ich also einen DNA-Computer mit interessanten Fähigkeiten bauen wollte, mußte ich die vorhandenen natürlichen Werkzeuge zweckentfremden. Das sind im wesentlichen folgende:

- Paarung komplementärer Stränge. Wenn ein DNA-Strang in wäßriger Lösung auf sein Komplement trifft, lagern sich beide passend zusammen und winden sich zur berühmten Watson-Crick-Doppelhelix umeinander. Was sie zusammenhält, sind nicht die klassischen chemischen (kovalenten), sondern die schwächeren Wasserstoffbrücken-Bindungen. Treffen zwei DNA-Stränge zusammen, die nicht oder zumindest nicht über längere Strecken komplementär zueinander sind, lagern sie sich auch nicht aneinander.

- Polymerasen. Das sind (Komplementär-)Kopiermaschinen, die nach dem beschriebenen Prinzip arbeiten. Um mit der Arbeit beginnen zu können, benötigt beispielsweise die DNA-Polymerase außer dem zu ergänzenden Strang einen sogenannten Primer, der ihr ein Anfangsstück zum Stricken vorgibt. Das kann ein (unter Umständen sehr kurzes) Stück einzelsträngiger DNA sein, das komplementär an die Vorlage gebunden ist. Die DNA-Polymerase verlängert jeden Primer, dem sie begegnet, in einer bestimmten Richtung zu einem komplementären Strang.

- Ligasen. Das sind Enzyme, die zwei hintereinanderliegende DNA-Stränge durch kovalente Bindungen zu einem längeren zusammenknüpfen. Sie reparieren zum Beispiel Stränge, die in Zellen der Haut durch intensive Ultraviolett-Bestrahlung gebrochen sind.

- Nucleasen. Im Gegensatz zu Ligasen zerschneiden sie Nucleinsäure-Stränge. Interessant sind vor allem die Restriktions-Endonucleasen, die ihre Scherenfunktion nur an bestimmten Stellen innerhalb des Moleküls ausüben. Das Darmbakterium Escherichia coli beispielsweise verfügt über ein Restriktionsenzym namens EcoRI, das DNA nach dem G in der Sequenz GAATTC zerschneidet – und fast nirgends sonst. Unter natürlichen Umständen verschafft diese molekulare Schere dem Mikroorganismus möglicherweise einen Schutz gegen Viren: Während er seine eigene DNA durch Anheften von Methylgruppen für EcoRI unangreifbar macht, wird die eines eindringenden Virus in Stücke geschnitten, denn die Sequenz GAATTC kommt fast unvermeidlich in jeder DNA häufig vor. In meinen DNA-Computern wurden Restriktionsenzyme nicht verwendet, wohl aber in den Nachfolgemodellen anderer Forschergruppen (siehe die "Mathematischen Unterhaltungen" in dieser Ausgabe, Seite 18).

- Gel-Elektrophorese. Dieses Verfahren haben wir nicht von den Zellen gestohlen. Man bringt eine Lösung aus verschiedenen DNA-Molekülen auf ein Gel auf und legt eine elektrische Spannung an. Da die Moleküle negativ geladen sind, bewegen sie sich auf die Anode zu – je kleiner, desto schneller. Mit dieser Methode kann man DNA-Moleküle also nach Größe (Stranglänge) sortieren. Nachdem das Feld eine gewisse Zeit angelegen hat, färbt man die DNA mit einem speziellen Farbstoff an und erkennt unter ultraviolettem Licht an dem entstandenen Bandenmuster, in welcher Menge Moleküle welcher Länge in der ursprünglichen Lösung vertreten waren.

- DNA-Synthese. Mittlerweile liefern spezialisierte Firmen jede beliebige – nicht zu lange – DNA-Sequenz auf Bestellung. Für 25 Dollar erhält man nach wenigen Tagen ein Reagenzglas mit ungefähr 1018 DNA-Molekülen von 20 Basenpaaren Länge, die alle (oder fast alle) von der angeforderten Bauart sind. Äußerlich ist das Ganze ein kleiner, trockener, formloser weißer Klumpen. Zur Zeit funktioniert das Verfahren zuverlässig bis zu einer Länge von ungefähr 100.

Diese Werkzeuge erscheinen nun nicht gerade geeignet, ein Schachprogramm auszuführen oder auch nur zwei Zahlen miteinander zu multiplizieren. Doch die großen Logiker der dreißiger Jahre haben uns etwas Wichtiges gelehrt: Rechnen ist unglaublich einfach. Man muß es nur in elementare Aktionen zerlegen. Ein Computer braucht im Prinzip lediglich zwei Bauteile: eines zum Speichern von Information und eines zur Verarbeitung der gespeicherten Information. Bei einer Turing-Maschine sind dies das Magnetband einerseits und die endliche Steuereinheit andererseits. Bei einem modernen Computer stecken viele und verschiedene Bauteile der einen wie der anderen Art in den Speicher- beziehungsweise Prozessorchips. Entscheidend aber ist: Auf die technischen Einzelheiten kommt es kaum an. Fast jede Methode, Information zu speichern, und nahezu jedes Sortiment von Operationen, diese zu verarbeiten, ist ausreichend, und zwar für alles, was überhaupt berechenbar ist.

Es genügt, die richtige Eingabeinformation bereitzustellen und darauf die Operationen in der richtigen Reihenfolge anzuwenden, das heißt ein Programm ablaufen zu lassen. Zur Speicherung von Information ist DNA hervorragend geeignet. Immerhin verwenden die Zellen sie seit Milliarden von Jahren genau dafür. Und sie verarbeiten die Information mit Enzymen wie Polymerasen, Ligasen und anderen. Aber war dies genug, einen universellen Computer zu bauen? Aufgrund der Lehren aus den dreißiger Jahren war ich davon überzeugt.



Hamiltonsche Wege



Es war jedoch klar, daß dieses Fernziel kaum in einem einzigen großen Schritt zu erreichen sein würde. Es galt klein anzufangen, mit einem DNA-Computer, der ein spezielles Problem löste – aber nicht zu speziell, damit das Potential der neuartigen Rechenmethode deutlich zutage trat. Ich entschied mich für das Problem des Hamiltonschen Wegs.

William Rowan Hamilton (1805 bis 1865) war Mitte des 19. Jahrhunderts königlicher Hofastronom in Irland. Das Problem, das heute seinen Namen trägt, läßt sich am besten auf einer Landkarte darstellen (Kasten auf Seite 73). Die Pfeile (gerichtete Kanten) stellen Direktflüge (oder auch Einbahnstraßen) zwischen den Städten (Knoten) auf der Karte (dem Graph) dar. Man kann zum Beispiel direkt von Boston nach Chicago reisen, aber nicht von Chicago nach Boston. Die Aufgabe besteht darin, einen Weg von Atlanta (dem Startknoten) mit Ziel in Detroit (dem Endknoten) zu finden, der alle anderen Städte (in diesem Falle Boston und Chicago) genau einmal besucht. Ein solcher Weg heißt Hamiltonscher Weg. Man sieht sofort, daß es im Beispiel genau einen Hamiltonschen Weg gibt: von Atlanta über Boston und Chicago nach Detroit. Wählt man dagegen Detroit als Start- und Atlanta als Zielknoten, dann gibt es offensichtlich keinen Hamiltonschen Weg.

Allgemeiner ausgedrückt: In einem gegebenen Graph mit gerichteten Kanten und ausgezeichnetem Start- und Zielknoten ist ein Hamiltonscher Weg eine Folge von Kanten, die im Startknoten beginnt, im Zielknoten endet und jeden Knoten genau einmal berührt. Das Problem ist, für einen beliebigen Graphen zu entscheiden, ob er einen Hamiltonschen Weg enthält.

Selbst diese bescheidene Forderung – man muß einen Hamiltonschen Weg nicht finden, wenn er existiert – ist mitunter sehr schwer zu erfüllen. Das Problem ist in der Informatik intensiv untersucht worden. Bisher konnte jedoch kein effizienter (das heißt schneller) Lösungsalgorithmus gefunden werden. Es sieht vielmehr so aus, als gebe es Graphen mit weniger als 100 Knoten, bei denen selbst die besten verfügbaren Algorithmen und Computer Jahrhunderte zur Lösung dieses Problems brauchen.

In den frühen siebziger Jahren wurde bewiesen, daß das Problem des Hamiltonschen Weges NP-vollständig ist. Ich kann an dieser Stelle nicht näher auf die Theorie der NP-Vollständigkeit eingehen; aber nach Überzeugung der meisten theoretischen Informatiker ist NP-vollständig gleichbedeutend mit schwer in dem Sinne, daß es keinen effizienten Algorithmus zur Lösung des Problems geben kann. (Dieses zu beweisen bleibt jedoch das wohl wichtigste offene Problem der theoretischen Informatik. Die Frage wird meist kurz als "P=NP?" formuliert.) Das heißt nicht, daß es für das Problem des Hamiltonschen Weges keinen Lösungsalgorithmus gäbe. Nur ist, soweit wir bis heute wissen, jeder denkbare Algorithmus entweder quälend langsam, oder er liefert nicht mit Sicherheit das richtige Ergebnis.

Das folgende Verfahren gehört zur zweiten Sorte (gegeben sei ein Graph mit n Knoten):

1. Erzeuge eine Menge zufällig bestimmter Wege durch den Graphen.

2. Für alle Wege in dieser Menge:

a. Überprüfe, ob der Weg mit dem Startknoten beginnt und mit dem Zielknoten endet. Falls nicht, entferne den Weg aus der Menge.

b. Überprüfe, ob der Weg genau n Knoten enthält. Falls nicht, entferne den Weg aus der Menge.

c. Überprüfe, ob außer Start- und Zielknoten auch jeder andere Knoten des Graphen im Weg enthalten ist. Falls nicht, entferne den Weg aus der Menge.

3. Wenn die Menge nicht leer ist, melde, daß ein Hamiltonscher Weg existiert, wenn sie leer ist, melde, daß es keinen gibt.

Dieser Algorithmus gibt möglicherweise eine falsche Antwort. Es könnte ja zufällig der einzige Hamiltonsche Weg, den es überhaupt gibt, in der zufällig erzeugten Menge fehlen. Wenn aber der (Pseudo-)Zufallsgenerator eine hinreichend große und hinreichend bunte Mischung bereitgestellt hat, erhält man immerhin mit hoher Wahrscheinlichkeit die richtige Antwort. Diesen Algorithmus habe ich in meiner ersten DNA-Berechnung realisiert.



Sieben Tage im Labor



Für mein Experiment wählte ich einen Graphen, der klein genug war, so daß das Problem des Hamiltonschen Weges im Labor lösbar war, aber groß genug, um als überzeugende Demonstration zu dienen. Ich wählte einen Graphen mit sieben Städten und 14 Einbahnstraßen (kleine Karte im Kasten auf Seite 73). Eine nichtwissenschaftliche Studie hat ergeben, daß ein Mensch durchschnittlich etwa 54 Sekunden braucht, bis er den einzigen Hamiltonschen Weg in diesem Graphen gefunden hat. (Schauen Sie auf den Sekundenzeiger Ihrer Uhr und beginnen Sie – jetzt...)

Zur Vereinfachung betrachten wir hier nur die Karte mit den vier Städten Atlanta, Boston, Chicago und Detroit und sechs Flugverbindungen zwischen ihnen (rechte Karte im Kasten auf Seite 73). Gesucht wird ein Hamiltonscher Weg, der in Atlanta beginnt und in Detroit endet.

Zuerst ordnete ich jeder Stadt eine beliebig gewählte DNA-Sequenz zu. In unserem Beispiel wurde Atlanta zu ACTTGCAG, Boston zu TCGGACTG und so weiter. Es ist hilfreich, die erste Hälfte der DNA-Sequenz als Vornamen und die zweite Hälfte als Zunamen aufzufassen: GCAG ist der Zuname von Atlanta und TCGG der Vorname von Boston. Als nächstes versah ich jeden Direktflug mit einer Kennung, nennen wir sie DNA-Flugnummer, die sich aus dem Zunamen der Ausgangsstadt und dem Vornamen der Zielstadt zusammensetzte. Im Beispiel bekam der Flug von Atlanta nach Boston also die Sequenz GCAGTCGG. Schließlich haben die Städtenamen (wie alle DNA-Stränge) Komplemente. Beispielsweise ist der komplementäre DNA-Name von Atlanta TGAACGTC.

Nachdem diese Codierungen festgelegt waren, ließ ich die komplementären Städtenamen – mit Ausnahme von Anfangs- und Zielstadt – und die Flugnummern synthetisieren (wie sich herausstellte, waren die DNA-Städtenamen selbst fast überflüssig). Ich gab eine winzige Menge (ungefähr 1014 Moleküle) von jeder der Sequenzen in ein gewöhnliches Reagenzglas. Das Auslösen der eigentlichen Berechnung gestaltete sich wie das Anrühren von Trockennahrung: Ich mußte nur Wasser, ein wenig Ligase, Salz und ein paar andere Zutaten hinzugeben, um annähernd die Bedingungen im Inneren einer Zelle herzustellen. Insgesamt wurde nur etwa ein fünfzigstel Teelöffel Lösung benutzt. Innerhalb einer Sekunde hielt ich die Lösung des Problems in der Hand.

Betrachten wir die Vorgänge im Reagenzglas genauer. Beispielsweise treffen mit einer gewissen Wahrscheinlichkeit die Flugnummer von Atlanta nach Boston (GCAGTCGG) und das Komplement des Namens Boston (AGCCTGAC) zusammen. Da der erste Strang mit TCGG endet und der zweite mit AGCC beginnt, lagern sich diese beiden komplementären Teilsequenzen überlappend aneinander. Begegnet der daraus entstehende Komplex der Flugnummer von Boston nach Chicago (ACTGGGCT), geschieht das gleiche, denn das Endstück des Komplexes (TGAC) ist komplementär zum Anfangsstück der Flugnummer (ACTG). Auf diese Weise entsteht eine Kette von Städten einerseits und Flugnummern andererseits, die wie eine Doppelreihe Legosteine, stets Stein auf Lücke gesetzt, relativ lose zusammenhalten (Bild 2). Eine Ligase schließt die Lücken im Rückgrat der Stränge und macht dadurch die ganze Doppelhelix stabil (Bild 3). Am Ende dieses Prozesses enthält das Reagenzglas Moleküle, die (wie im ersten Schritt des Algorithmus gefordert) zufällig ausgewählte Wege durch die Städte darstellen: Jede Sequenz kann zufällig Startpunkt der Reaktion werden, und die Anzahl der überlappenden Stücke variiert.

In einem einzigen Akt entstehen somit ungeheuer viele mögliche Wege durch den Graphen – durch gleichzeitige chemische Reaktion von buchstäblich Hunderten von Billionen Molekülen. Der DNA-Computer hat alle auszutestenden Möglichkeiten zugleich bereitgestellt. Vom Standpunkt des Informatikers ist das massiv parallele Datenverarbeitung.

Da ich mit einer großen Anzahl von DNA-Molekülen begonnen hatte und das Problem nur sehr wenige Städte enthielt, war so gut wie sicher, daß zumindest eines der entstandenen Moleküle dem Hamiltonschen Weg entsprechen würde. Es ist auf den ersten Blick befremdlich, aber wahr: Die Lösung eines mathematischen Problems ist in einem einzigen Molekül gespeichert. Auf unserer Karte gibt es nur einen Hamiltonschen Weg, und zwar durch die Städte Atlanta, Boston, Chicago und Detroit, in dieser Reihenfolge. Das Molekül, das der Lösung des Problems entspricht, hat demnach die Sequenz GCAGTCGGACTGGGCTATGTCCGA (Bild 2).

Ich hatte also mit ziemlicher Sicherheit das richtige Molekül im Reagenzglas – aber eben auch ungefähr 100 Billionen falsche. Die galt es, getreu dem oben genannten Algorithmus auszusondern; im ersten Schritt diejenigen, die nicht die richtige Anfangs- und Zielstadt hatten. Dazu verwendete ich die Polymerase-Kettenreaktion (PCR). Mit dieser Technik lassen sich gezielt und in großen Mengen DNA-Moleküle vervielfältigen, die zu vorgegebenen Primer-Sequenzen passen (siehe "Eine Nachtfahrt und die Polymerase-Kettenreaktion" von Kary B. Mullis, Spektrum der Wissenschaft, Juni 1990, Seite 60). Auf diese Weise konnte ich die falschen Sequenzen zwar nicht eliminieren, aber die richtige so stark vermehren, daß die falschen in der Masse untergingen.

Die Polymerase-Kettenreaktion wird durch zyklisches Erwärmen und Abkühlen der Lösung vorangetrieben. Bei mäßiger Wärme arbeitet die DNA-Polymerase am besten und ergänzt Einzel- zu Doppelsträngen; in einer heißeren Umgebung trennen diese sich wieder voneinander, so daß im nächsten Zyklus wieder Einzelstränge zur Verfügung stehen (Bild 4).

Als Primer verwendete ich den Zunamen der Anfangsstadt (GCAG für Atlanta) und das Komplement des Vornamens der Zielstadt (GGCT für Detroit). Der erste veranlaßte die DNA-Polymerase, Sequenzen zu der richtigen Anfangsstadt zu erzeugen, während der zweite die entsprechende Wirkung für die richtige Zielstadt hatte (Kasten auf Seite 75).

Auf diese Weise wurden Moleküle, die sowohl die richtige Anfangs- als auch die richtige Zielstadt enthielten, mit exponentiell ansteigender Rate reproduziert: Mit jedem Schritt verdoppelte sich ihre Anzahl. Dagegen wuchs die Anzahl der Moleküle, die nur eine der beiden Städte richtig enthielten, lediglich proportional zur Anzahl der Vervielfältigungsschritte. DNA-Sequenzen, bei denen weder die Anfangs- noch die Zielstadt die richtige war, wurden überhaupt nicht repliziert. Eine kleine Probe, die ich nach Beendigung der PCR der Lösung entnahm, enthielt also eine erdrückende Mehrheit von Molekülen mit der richtigen Start- und Zielstadt und (wenn überhaupt) nur sehr wenige, die diese Bedingung nicht erfüllten. Damit war Schritt 2a des Algorithmus ausgeführt.

Als nächstes sonderte ich mittels Gel-Elektrophorese die Moleküle mit der richtigen Länge (im Beispiel 24) aus und verwarf die übrigen. Damit war auch Schritt 2b des Algorithmus erledigt.

Es blieb Schritt 2c auszuführen: Die verbleibenden Sequenzen waren daraufhin zu überprüfen, ob sie alle Zwischenstationen enthielten. Dazu veranstaltete ich eine Auslese nach Affinität (affinity separation). An mikroskopisch kleine Eisenkugeln von ungefähr einem Mikrometer Durchmesser lagerte ich sogenannte Sonden-Moleküle an, DNA-Einzelstränge, die in diesem Beispiel dem komplementären Namen einer bestimmten Stadt wie Boston entsprachen. Unter Bedingungen, welche die Basenpaarung begünstigten, verrührte ich diese Kugeln in dem Reagenzglas mit den verbliebenen, wieder in Einzelstränge aufgetrennten Molekülen. Diejenigen unter ihnen, die den richtigen Stadtnamen (Boston) enthielten, verbanden sich mit den Sonden. Indem ich die Kugeln mit einem Magneten an der Wand des Reagenzglases festhielt und den flüssigen Teil der Lösung ausgoß, entfernte ich alle Moleküle, die diesen Namen nicht enthielten (Bild 5). Dann füllte ich frische Flüssigkeit in das Reagenzglas und entfernte den Magneten, um die Kugeln freizugeben. Nach einer Temperaturerhöhung trennten sich die Moleküle wieder von den Sonden und vermengten sich mit der Flüssigkeit. Mit dem Magneten hielt ich abermals die Kugeln – jetzt wieder im Originalzustand – an der Wand des Reagenzglases zurück, während ich die Lösung, die nur noch die gewünschten DNA-Stränge enthielt (im Beispiel Wege über Boston), in ein neues Reagenzglas abgoß. Der ganze Vorgang wurde für die restlichen Zwischenstationen (im Beispiel nur noch Chicago) wiederholt. Dieser Verfahrensschritt kostete mich einen kompletten Labortag und war der langwierigste Teil des Experiments.

Nach dessen Abschluß mußten die DNA-Moleküle im Reagenzglas genau diejenigen sein, die einen Hamiltonschen Weg darstellten – wenn überhaupt noch welche übrig waren. Schritt 3 des Algorithmus bestand also darin, festzustellen, ob das Reagenzglas überhaupt noch DNA enthielt. Dieser Test ließ sich mit einem weiteren PCR-Schritt und nachfolgender Gel-Elektrophorese durchführen. Zu meiner Freude ergab die abschließende Analyse, daß die verbliebenen Moleküle tatsächlich den Hamiltonschen Weg darstellten. Nach sieben Tagen im Labor war die erste DNA-Berechnung vollendet.



Ein neues Gebiet entsteht



Was wird die Zukunft bringen? Molekulare Computer werden, wenn sie erst einmal existieren, viele attraktive Eigenschaften haben. Sie speichern Information mit extrem hoher Dichte: Ein Gramm DNA (ungefähr ein Kubikzentimeter im trockenen Zustand) enthält so viel Information wie eine Billion CDs. Sie leisten massiv parallele Informationsverarbeitung: Selbst in dem winzigen Experiment mit einem Tröpfchen Lösung wurden annähernd 1014 DNA-Flugnummern gleichzeitig verkettet, und zwar innerhalb von etwa einer Sekunde. Es ist nicht sicher, ob der schnellste heute verfügbare Supercomputer mit dieser Geschwindigkeit mithalten könnte.

Molekulare Computer sind außerdem, zumindest theoretisch, ungeheuer energieeffizient. Im Prinzip ist ein Joule für ungefähr 2×1019 DNA-Verknüpfungsoperationen ausreichend. Das ist insofern bemerkenswert, als nach dem zweiten Hauptsatz der Thermodynamik mehr als 34×1019 (irreversible) elementare Operationen pro Joule (bei Zimmertemperatur) überhaupt nicht möglich sind (vergleiche "Maxwells Dämon" von Charles H. Bennett, Spektrum der Wissenschaft, Januar 1988, Seite 48). Existierende Supercomputer sind von dieser theoretischen Grenze um viele Größenordnungen weiter entfernt: Sie erreichen allenfalls 109 Operationen pro Joule.

Wissenschaftler in aller Welt arbeiten in Theorie und Praxis daran, diese Eigenschaften auszuschöpfen. Wird es ihnen gelingen, molekulare Rechner zu bauen, die mit elektronischen konkurrieren können? Das bleibt abzuwarten. Riesige finanzielle und intellektuelle Investitionen haben im Verlauf eines halben Jahrhunderts die elektronischen Computer zu den Wundern unseres Zeitalters schlechthin gemacht; es wird nicht einfach sein, sie zu übertreffen.

Aber es wäre kurzsichtig, nur den praktischen Aspekt dieser Forschung zu berücksichtigen. Mein Experiment eröffnet einen neuen Bereich der Wissenschaft. Er wird ermöglicht durch unsere rapide voranschreitende Fähigkeit, die molekulare Welt zu beherrschen. Diese neue Molekular-Wissenschaft wird bereits an vielen Stellen betrieben. Zum Beispiel veranstaltet Gerald F. Joyce vom Scripps-Forschungsinstitut in La Jolla (Kalifornien) eine Art gezielter Züchtung mit Billionen von RNA-Molekülen, bis sich schließlich Moleküle mit den gewünschten katalytischen Eigenschaften entwickeln (siehe seinen Artikel "Gelenkte Evolution von Biomolekülen", Spektrum der Wissenschaft, Februar 1993, Seite 52). Julius Rebek jr. vom Massachusetts Institute of Technology in Cambridge entwickelt selbstreproduzierende Moleküle, die uns Informationen über die mögliche Entstehung des Lebens liefern können (siehe seinen Artikel "Künstliche Moleküle, die sich selbst vermehren", Spektrum der Wissenschaft, September 1994, Seite 66). Angeregt durch die Forschung auf dem Gebiet der DNA-Computer synthetisiert Erik Winfree vom California Institute of Technology in Pasadena "intelligente" molekulare Komplexe, die darauf programmiert werden können, sich selbst zu vorbestimmten Strukturen beliebiger Komplexität zu organisieren. Es gibt zahlreiche weitere Beispiele, und wir sollten das enorme Potential dieses neuen Gebietes intensiv kultivieren.

Mir selbst genügt es zu wissen, daß Berechnungen mit DNA möglich sind. Im vergangenen halben Jahrhundert sind Biologie und Informatik aufgeblüht, und zweifellos werden sie für unseren wissenschaftlichen und ökonomischen Fortschritt im neuen Jahrtausend von zentraler Bedeutung sein. Biologie und Informatik – Leben und Berechnen – sind eng miteinander verflochten. Ich bin davon überzeugt, daß an ihren Berührungspunkten große Entdeckungen auf diejenigen warten, die nach ihnen suchen.

Literaturhinweise

Molecular Computation of Solutions to Combinatorial Problems. Von Leonard M. Adleman in: Science, Band 266, Seiten 1021 bis 1024, 11. November 1994.

On the Path to Computation with DNA. Von David K. Gifford in: Science, Band 266, Seiten 993 bis 994, 11. November 1994.

DNA Solution of Hard Computational Problems. Von Richard J. Lipton in: Science, Band 268, Seiten 542 bis 545, 28. April 1995.

Informationen über DNA-Berechnungen findet man unter http://users.aol.com/ibrandt/dna_computer.html im World Wide Web.

Eine aktuelle Bibliographie mit vielen weiterführenden Verweisen findet man unter http://www.wi.LeidenUniv.nl/~jdassen/dna.html im World Wide Web.


Aus: Spektrum der Wissenschaft 11 / 1998, Seite 70
© Spektrum der Wissenschaft Verlagsgesellschaft mbH
11 / 1998

Dieser Artikel ist enthalten in Spektrum der Wissenschaft 11 / 1998

Lesermeinung

Beitrag schreiben

Wir freuen uns über Ihre Beiträge zu unseren Artikeln und wünschen Ihnen viel Spaß beim Gedankenaustausch auf unseren Seiten! Bitte beachten Sie dabei unsere Kommentarrichtlinien.

Tragen Sie bitte nur Relevantes zum Thema des jeweiligen Artikels vor, und wahren Sie einen respektvollen Umgangston. Die Redaktion behält sich vor, Leserzuschriften nicht zu veröffentlichen und Ihre Kommentare redaktionell zu bearbeiten. Die Leserzuschriften können daher leider nicht immer sofort veröffentlicht werden. Bitte geben Sie einen Namen an und Ihren Zuschriften stets eine aussagekräftige Überschrift, damit bei Onlinediskussionen andere Teilnehmer sich leichter auf Ihre Beiträge beziehen können. Ausgewählte Lesermeinungen können ohne separate Rücksprache auch in unseren gedruckten und digitalen Magazinen veröffentlicht werden. Vielen Dank!

  • Infos